How Are Your Telomeres? They Could Be the Key to How Fast You’re Aging
Articles Blog

How Are Your Telomeres? They Could Be the Key to How Fast You’re Aging


Getting more sleep doesn’t just help you
wake up refreshed in the morning. It can also literally keep you young. New studies show that those who are under
stress and don’t get enough shuteye could age up to six times faster than they would
otherwise, giving a whole new meaning to the term beauty rest. It all comes down to a part of our genetic
toolkit called our telomeres. See, we’re made up of approximately 30-40
trillion cells of human tissue, and the DNA for each of those cells is tightly coiled
up into chromosomes, which are housed in the nucleus of each cell. While we’re just living our lives, going
about our business, our cells are replicating all the time. Every time a cell divides, the chromosomes
have to be copied as one cell splits into two during mitosis. And during that cell replication process,
telomeres act as protective caps on the ends of our chromosomes. Like, if our chromosomes are shoelaces, then
telomeres are the little plastic tips on the ends of those shoelaces that keep them from
fraying away. In most living things, including us, telomeres
are made of hundreds to thousands of repetitions of the simple nucleic acid sequence TTAGGG. This cap does a lot of things, including telling
our cellular machinery where one chromosome ends and another begins. They also serve as a buffer during the copying
process, because cell replication isn’t perfect. The little tool that does the DNA copying
isn’t as precise as you might hope, and can’t properly replicate the very ends of
the chromosomes—this can cause a lot of issues, and is called the end replication
problem. To avoid that chop-chop happening to your
actual DNA—y’know the important stuff that tells your cells what to do—your telomeres
take the hit instead and every time a cell divides, a little chunk of the telomere is
lost in the process. So telomeres shorten with each cell division,
but they also get shorter as you age. Like, even when you’re producing new cells,
your telomeres are now shorter than they once were when you were younger, a trend called
‘telomere attrition’. This means that your chromosomes are less
protected from damage during cell replication. Which is what scientists believe could be
behind the decreased function and wellness of our bodies as we age, and could lead to
degenerative diseases like Alzheimer’s. This info may now have you wondering, ‘well
jeez, Louise, what do I have to do to keep my telomeres from shortening as I age?’ On a certain level, there may not be much
you can do about it. Your telomeres’ length and how fast they
shorten throughout your lifetime is highly variable. Estimates say anywhere from 30-80% of your
telomere’s characteristics could be due to genetic factors and other things out of
your control like your father’s age at the time you were conceived. But, there’s good news: there are some things
under our control. While telomeres are the protectors of our
DNA, they are also very susceptible to damage themselves by—most notably—stress. Stress is an ambiguous word, but can come
in a multitude of forms: smoking, obesity, exposure to trauma, a psychological disorder
like major depression, and so much more, all of which can lead to physical effects like
higher levels of stress hormones and the presence of inflammation. Which are associated with acceleration of
telomere shortening. And as we’ve already established, telomere
shortening is not good for your health. Just thinking about telomere shortening is
stressing me out and probably shortening my telomeres! Man, I really need to get more sleep. Exercising, staying away from cigarettes,
doing what you can to destress might actually add years to your life in the form of telomere
length preservation. But saving your telomeres from excess shortening
won’t necessarily save you from the things you’re genetically predisposed for. It just means they may happen to you later,
rather than sooner. And aside from making good lifestyle choices,
there may be something we can take advantage of to lengthen our telomeres built right into
our cellular machinery. Telomerase is an enzyme that lengthens telomeres. In our adult stem cells, which is where new
cells in our body come from, and our germ cells, which make sperm and eggs, telomerase
is busy building those telomeres back up. If we could somehow get telomerase to build
back the telomeres in our somatic cells, our regular body cells, that would be great! But the problem is that turning telomerase
on is actually associated with cancer because, again, cells aren’t meant to just replicate
forever and if they do, it can be a problem. These complex questions about telomere length
and what we can do about it is a huge research field and we are just skimming the surface
here, so let us know if there’s something in particular you’d like us to cover. All this telomere business has really important
implications for our future in medicine and other kinds of innovation. Dolly the cloned sheep, for example, was born
with shortened telomeres and actually died prematurely, telling us we’ll need to take
telomere science into consideration when working on extremely ambitious synthetic organisms. Scott Kelly, the astronaut who spent a year
aboard the International Space Station, experienced significant telomere shortening due to the
stress his body was exposed to in space. And now you have some serious scientific backing
when saying that taking some chill time is good for your health. Fun Fact: Telomeres are made of the same amino
acid sequence in almost every prokaryote, meaning they are HIGHLY conserved. Your telomeres are the same as a protists,
as a sloths, as a ladybugs. That’s pretty cool. Wanna know more about what happened to Scott
Kelly’s DNA during his year in space? Check out this video here and make sure to
subscribe for more genetic deep-dives. Thanks for watching.

100 thoughts on “How Are Your Telomeres? They Could Be the Key to How Fast You’re Aging

  1. Hi everyone! You may have noticed, we mixed up our sequences! Instead of amino acid sequence, we mean the nucleotide sequence. There's a special protein component of telomerase called telomerase reverse transcriptase, or TERT, that associates with amino acid sequences, but that’s not what we’re discussing here. Thanks for catching, and comment below with more deep dives you want Elements to cover.
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2238860/

  2. Check out lifespan.io's rejuvenation roadmap to see how treatments of telomeres attrition are coming along!

  3. I need a DNA strain that increases my lifespan of another 100 years. So I can watch everyone’s grandchildren burn this world to its foundation. Pretty much like we’ve been doing all these centuries.

  4. For once this is a topic I already knew a whole lot about, so it was easier to notice how well-written it was. I just have to applaud how well this was explained with both detail and clarity! This channel is a great educational resource. 🙂 keep it up guys

  5. Good. Good. Everything will balance out. If your life is pure stress, you want to die sooner, and that wish will be granted.

  6. So it's the reason of aging. Now if skin care companies see this they will advertise their cream as 'telomere increasing'

  7. i really enjoy this channel in that it is presenting subject matter in smart intelligent formats….I really doubt that it would actually be possible to live 6X longer than otherwise, many people can live 100 years and some even have diseases or stressors so what if they didn't have these issues, would they live 600 years? also, could we just learn lessons from cancer and engineer our cells to the point that no cell division is needed (unless to repair) and thus be engineered to live forever: wasn't there a jellyfish that could do that?

  8. I took TA 65 for almost a year and I couldn't afford it anymore because it was too expensive this was a few years ago, now they claim it's more potent for about the same price but I don't know if it really works or not it seems like I've got more problems now, my ear is scabbed over and will not heal.

  9. Me: life is short so die at 100 years old
    Internet pepperoni people: f you I am immortal on the internet
    Me on the dark sides: unplugged the internet server
    All the people using the internet: what the f!

  10. Watch how the replication works… the "tool" latches on to the dna and travels towards the end of the dna duplicating as it goes… then poof it hits the end. and the tool stops duplicating, and the very very end gets left off the duplication process… tele meres are long and can loose some.. just needs to be added to.

  11. Too bad we can’t create artificial telomeres that can just attach to already damaged natural ones :/
    Like a prosthetic ig lol.

  12. How is depression controllable ? Just undermined so many peoples mental illness’s, really disrespectful, maybe look at the script twice next time.

  13. Could you guys do a video breaking down the stuff about this potential cure for Alzheimer's that researchers at UNM Hospital in Albuquerque New Mexico have made?

  14. Great intro to telomeres! How about a video with a wider picture?
    Telemere length isn't the only key to how fast you're aging. While researchers in the anti-aging field may quibble over relative factor importance, Aubrey De Grey's 7 causes of aging isn't controversial like it once was.
    lots of amazing material to cover here… sens.org, the methusela mouse project, nad+ precursor supplementation, senolytics, human lifespan being already long for a mammal our size (only bats and naked mole-rats outlive us, when lifespan is adjusted by weight), why the mouse model gets results that don't always translate to humans.

  15. Prophet Muhammad had said that every disease Allah have made a cure except old age and death.. Even is you looks young, your genes not

  16. I imagine, excess free radical production through sugar metabolism is also a cause of telomere damage and may explain both the cause of cancer and the fact that cancer thrives on sugar metabolism.

  17. This is old news you'd be better off looking into sirtuins, NAD and resveratrol if you want to be on the cutting edge of longevity research .

  18. Aging is the acumulation of damage… nothing more.. just like a car get old.
    No "new cell" are being made lol.. they all divide

  19. TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGGTTAGGG
    TTAGGGTTAGGG
    TTAGGG

    uh-oh!

  20. https://www.washingtonpost.com/science/2019/04/11/kelly-twin-astronauts-study-shows-harsh-effects-space-flight-brutal-return-earth/?noredirect=on&utm_term=.dc341f04685e

    NASA Kelly twins study

    Blood samples indicated that his telomeres which erode over time as part of the natural aging process — lengthened in space. But space is no fountain of youth: The telomeres shortened dramatically when he returned to Earth.

  21. 4 step plan on how to live forever.

    1: Get telomerase to work in all of your cells
    2: Make the immune system EXTREMELY good at killing cancer
    3: Don't die from any non-age related causes.
    4: Profit

  22. What about cancer cells, if they, in theory, can divide indefinitely, can't we just study those cells to figure out the ways to reduce telomeres shortening in healthy cells?

  23. I'm subscribed, and clicked the bell months ago, but it doesn't seem my Seeker updates come on like the other stuff I'm subscribed to. Why Google no likey my Seeker?

  24. Use telomerase to maintain the telomerase length I need healthy cells, and use Chimera therapy to teach your immune system to recognize cancer.

  25. The relationship between stress and sleep has always been obvious. Before going into the white house every U.S. president looked attractive and young. After their first or second term, every U.S. president looks 20 years older. The stress associated with being President continues to hyoer-age every president.

  26. I would love to learn more about this. All I've ever come across is this basic information. So how might we avoid developing cancer? I've learned along the way that even with sufficient protection from our telomeres, DNA can become corrupt during the replication process. What's going on to thwart that? What are some of the other things about this topic I don't know to ask because no one seems to want to go into this deeper?

  27. If we weren't trying to make profit off human life, we'd have already cured many sicknesses but that doesn't make profit.. so no matter if you stress or not eventually you'll die.. and if not then you can be on 5 or more drugs per day to keep you functioning..

  28. Aging is also caused by epigenetic factors; especially, free radicals and DNA methylation. Telomeres do cause aging, but carcinogens cause oxidative stress that will definitely age you quick, just ask a fisherman at the local bar.

Leave a Reply

Your email address will not be published. Required fields are marked *

Back To Top