Top 10 SURPRISING Facts about GMOs (Genetically Modified Organisms)
Articles Blog

Top 10 SURPRISING Facts about GMOs (Genetically Modified Organisms)


Top 10 Surprising Facts about Genetically
Modified Organisms (GMOs) 10. All Of Your Apples Are Actually Clones Apples are one of the most unassuming and
ubiquitous fruits in existence. They go in cider, alcoholic cider, juice,
pies, and about everything you can imagine. There are enough varieties to satisfy almost
everyone, and many different types are cherished for how well they work for different purposes. Some people would be loath to go without Granny
Smith apples when baking a pie, but probably wouldn’t want to eat one by itself as a
hand fruit. One of the things that are most beloved about
apples are all the delicious varieties, but many people don’t realize that every single
apple they are eating is the fruit equivalent of a clone. Many people chalk up the uniformity of their
produce to marketers throwing out vast amounts of food that doesn’t fit the look they think
consumers want, and this is true for most products, but in the case of apples, farmers
have to go the extra mile. The way apples grow, if you just let them
grow naturally, they will come up with something different tasting and unique every single
time. It might be close and have some characteristics,
but it will be a different fruit altogether. This has allowed farmers to experiment and
create some amazing varieties, but it also means that you don’t just plant a “red
delicious” apple seed. You take a branch from a previous red delicious
apple tree and graft it onto a different young apple tree at the right time in its life. If we did not graft apple trees, all of our
favorite varieties of apple would have long ago ceased to exist. 9. GMO’s Have Been Around For A Very Long Time Many people misunderstand GMO’s to be a
recent invention, but for those who know their origins, the backlash can seem a little over
the top. Some of the people who are most active against
GMO’s misunderstand and think that this is something that only started happening recently. While some of the methods used today may be
more advanced, and it’s perfectly acceptable to question processes, attacking the very
concept of genetic modification of food and livestock is a strange position to take. Just as an example, scientists have recently
found evidence of sweet potatoes that were genetically modified by farmers 8,000 years
ago. The farmers needed a new and better food source,
so when they found a plant that seemed to be a good crop, but wasn’t quite edible,
they decided to work around that. These farmers used a bacteria that they introduced
into the crop – which added new DNA – and it caused it to flourish into something that
would actually be edible. Scientists have found that all sweet potatoes
so far share this gene, which means that all sweet potatoes are millennia old GMO’s. Scientists also believe that the process the
farmers used to create the sweet potatoes we know today is incredibly similar to the
process food scientists use today for GMO crops. 8. In A Consumer Poll 80% Of People Wanted Mandatory
Labeling On Food With DNA Last year an annual consumer poll asked people
about GMO’s as well as questioned people on whether they supported mandatory labeling
on food containing DNA. As most of you probably know, DNA is the basic
building blocks of all life – you won’t find food products without it. However, roughly 80% of the people polled
said that they wanted mandatory labeling for any food or drinks that had DNA. Many people were quite alarmed when seeing
the poll, because it shows such a complete misunderstanding of basic science. However, some people have claimed that the
poll may have been somewhat misleading. They point out that a similar number of people
polled wanted more labeling for GMO products, which means people may have thought that it
was essentially a similar part of the same question. The disturbing issue remains though – even
if the consumers polled thought they were just answering a question about GMO’s, it
shows that they did not have any idea what DNA really is. It is also interesting to note that the same
people on the poll who gave this answer that showed a stunning lack of scientific knowledge,
also polled as being very anti-GMO. This doesn’t mean we are suggesting that
those who have concerns about GMO’s don’t understand science, but it is clear that there
is a lot of confusion and misinformation regarding the entire issue. 7. Neil Degrasse Tyson’s Take On GMO’s Neil Degrasse Tyson is a very well-known figure
in today’s society. As a scientist he has name recognition and
great respect among the average American, and has used that as a vehicle to educate
the public about basic science whenever he can get the chance. He even hosted a short TV show of the same
name as a homage to Carl Sagan’s The Cosmos. It was inevitable then, that eventually he
would get into the debate about GMO’s. Last year he came out writing that he felt
that the backlash against GMO’s was largely anti-science, and many people erupted in a
furor against him, causing him to explain his comments even further. He explains that while it’s okay to be concerned
about large companies like Monsanto and how much control they have over food production,
or to be concerned about specific issues or processes involved in food production or modification,
but that being against genetic modification in general is not sensible. We have been using methods – perhaps not
as advanced as some today – to modify our foods and our livestock for thousands of years. We have selected for specific traits, spliced
plants together and gone to great lengths to change the nature around us to better suit
our needs. Tyson’s overall point is that our tendency
to do that has certainly not stopped the human race from thriving. He also wrote on Twitter that even your dogs
and cats are GMO. 6. Many People Mean Something Very Different
When They Say They Are Anti-GMO GMO’s are a controversial topic these days,
and it seems that there is more than one type of person who is raising concerns about the
topic. On the one hand there are those who are legitimately
concerned with certain specific issues regarding actions by some big companies and will occasionally
highlight a specific process. It’s not unreasonable either to question
specifics about any process, whether it’s been proven to be safe or not. However, especially in light of polls where
some people against GMO’s don’t understand the role of DNA, it seems there is another
type of anti-GMO activist who is really against big companies like Monsanto for alleged abusive
business practices – as well as accusations they are trying to take over the world – and
not so much for the actual genetic modification of food and livestock. Some people have argued that some of the crusades
against Monsanto have not been entirely fair, and may be a product of hysteria more than
anything else. Of course this doesn’t mean they aren’t
trying to grow their company and become as strong a global force as possible – most
companies aspire to this – and many big companies will gladly stomp on small businessmen,
or farmers, who don’t want to play ball with them. It may well be that Monsanto has been involved
in many shady business practices, but if that is what people are against they should fight
the ethics of the company itself, not the concept of genetic modification. It only plays into their hands to muddle the
larger issue instead of focusing on them specifically. 5. Some Of The Claims Against Monsanto Are Overblown One of the most popular claims about the evils
of Monsanto is that they go after farmers who use their seeds without paying royalty
fees and try to take them down. There is some truth to this – if you try
to use their seeds without every paying anything to them they will ask for their royalty fees. However you feel about this, it is not particularly
surprising, or the most unreasonable demand you will ever hear of a corporation. The even more popular claim is that Monsanto
waits for poor farmers who have accidentally had pollen from Monsanto’s seeds blow to
their fields, and then sue the poor farmers who could never have prevented this. It has been shared widely as an example of
them being insanely, gleefully evil, but it doesn’t hold up to scrutiny. While most people were under the impression
Monsanto was doing this left and right, the truth was the story broke when a group of
farmers sued Monsanto – not the other way around – citing the possibility that Monsanto
could sue them for that in the future. The judge thought the claim was insane since
Monsanto hadn’t even tried to sue them yet, and threw out the case. There is one case where a man claims Monsanto
was suing him unfairly, but later admitted to planting some of their seeds in his fields,
and then later saving the seeds from crop production and using them in his fields – in
other words he sank his own case and admitted it was no accident they ended up in his fields. Some people may still be concerned about seeds
having royalties attached in the first place, and that is a fair debate to have, but Monsanto
isn’t bankrupting farmers with lawsuits because some pollen from Monsanto seeds drifted
to the farmer’s property. 4. The World Seed Bank Is Supported By Many In
The Biotechnology Movement For those who aren’t aware of it, the World
Seed Bank is located in Norway and is a project that spans many countries of the world. The idea is to keep a safe stock of every
kind of seed imaginable in the case of global catastrophe. Whether it were to be a drought in only one
part of the world, or something that affected much of the globe, the seed bank is designed
to ensure we can rebuild our flora if necessary. The seed bank has many seeds that are GMO,
and while this makes especial sense because a doomsday vault would be a good place to
experiment with seeds resistant to all kinds of difficult conditions, many people are concerned
about the backers of the vault. Bill and Melinda Gates and their foundation
have donated a very significant chunk of money into the project, and Monsanto and other biotechnology
companies have had a hand in the effort as well. The people at the core of the projects functioning
are biotechnology experts. Considering that Bill Gates is already the
subject of a plethora of conspiracy theories, it is not surprising that many of the same
people who are against GMO’s are not convinced that the seed bank is really a good thing. 3. The FDA Does Not Have Strict Labeling For
GMO’s Many of the people who are concerned about
GMO’s think that the government is, indeed, making sure that they know what has been modified. However, the truth is that while the FDA will
test all new foods that enter the market to see if they are safe, whether or not they
are genetically modified is not something that matters to the FDA at all – it simply
isn’t a part of their process. In a recent decision on Genetically Engineered
Salmon, where they concluded that it was safe to eat, they explained that it is not mandatory
for food suppliers to explain whether the salmon they are selling is GE or not. The FDA does offer a process for voluntary
labeling, but states that it is only for companies that wish to make the distinction to their
customers. While some people may be concerned with whether
something has been genetically modified, it’s clear the FDA does not think that the fact
of modification matters in and of itself. While it may seem dismissive of them, the
truth is that the FDA still has stringent standards. You can’t just create a new genetically
modified product and start selling it – it has to be tested and approved as safe for
human consumption first. It’s just that whether or not it has been
genetically modified has nothing to do with whether or not it will be accepted. 2. Some GMO’s May Be Good For The Environment It’s curious that many of the same people
railing against GMO crops are also many of the same people who are greatly worried about
the environment. They may not realize that many of the modifications
are designed in order to have less of an environmental impact. Many GM crops are modified so that they will
have natural insecticides of various sorts, which is one way of reducing an incredible
amount of noxious artificial pesticides being sprayed into the air every year. They are also designed with traits that help
increase overall yield, and are often resistant against various different weather problems. With many environmental issues plaguing farmers
today, this is nothing but a good thing. A meta-analysis of 147 different studies of
GM plants found that farmers were getting about 20% better yield in terms of crops,
but also using almost 40% less pesticides. Pesticides tend to be incredibly harmful to
the environment, so any major reduction would be a great benefit to air quality. Another interesting thing these studies found
is that smaller, poorer countries were actually getting even more yield, and even greater
use, out of using GM seeds. This means that they could be especially helpful
in parts of the world where many people are going hungry. 1. Some Countries Have Taken An Extreme Stance
Against GMO’s In 2015 many countries around the world were
shocked when several countries that were known for at least fairly intelligent policies normally,
decided to take an extremely strange stance and ban all GM crop cultivation. These countries included Germany, France,
Austria, Denmark, Greece, Hungary, The Netherlands, Italy, and Poland. Russia also came out sometime last year and
made a big deal about banning GM corn and other similar crops. While some around the world cheered this decision
on, many were completely baffled. Scotland also joined in the decision, while
England led the charge in Europe of those saying that the decision was completely inane. Some people have legitimate issues about biotech,
but the problem was that several political leaders openly admitted that they hadn’t
even consulted their science advisers about the issue, and that it was really about keeping
up their green reputation around the world – because many people currently associate
anti-GMO with being a green party type. It’s hard to deny, no matter what side of
the issue you fall on, that deciding a scientific issue based on your reputation instead of
actually considering the science is completely ridiculous. Some people have pointed out that not only
was the decision incredibly politically based, but that it was also hypocritical in the extreme. Many of these countries import vast amounts
of GMO livestock feed every year, so it’s clear the anti-GMO stance is just for appearances.

100 thoughts on “Top 10 SURPRISING Facts about GMOs (Genetically Modified Organisms)

  1. So … basically people who question the unwavering benefits of GMOs are stupid. Got it. Welcome to the pro-Capitalist echo chamber.

  2. If we don't do something soon, GMOs and vaccines are going to be used less and less until we aren't using them anymore and millions of people are going to die as a result. Most GMOs are the reason there aren't MORE starving people in 3rd world countries. It boggles my mind at how scientifically illiterate the general population can be.

  3. the dangerouse gmo is things like wheat or soy that is sprayed with round up "week killer" just before harvest to maximize seed out for more production

  4. There were also some settled lawsuits with Monsanto. It's unclear if Monsanto bought intellectual property from farmers in a compromised legal position, but this is my guess. This was a reasonable solution to me, though I'd prefer to keep some people breeding corn and other crops, so, contamination is still a problem. I still assume that reasonable claims will result in Monsanto buying intellectual property, just don't try and screw them over, although farmers having assets makes them harder to deal with. It's probably harder to deal with a US farmer than large numbers of peasants overseas, lol. I mean, I've seen many complaints lodged of them acting as a patent prospector/speculator which is a thing that is rather detested in the US. That stuff has been years ago.

  5. The cannabis plant is one of the most GMO plants on the planet. How many hippies do you know are anti-GMO? Hippies and drug cartels keep making it more and more potent by modifying the organism.

    I wish the scientists would hurry up and put things in Beef to make the consumer smarter. That way the anti-gmo people will stay away from it and the pro-Science people would get smarter. OMG! make Bacon a GMO, that way Bacon will make you smarter. 😀

    Are your paranoid senses tingling? MWAhahahahahahahahahahahaaaa! >:-)

    EDIT:
    I have one more question. Are Transsexuals GMO humans? They go through gene therapy to get their hormones changed right?

  6. "GMO's are saposted to be better for the invioment" yet it's this the natural pesticide in them that has vastly contributed to the decline in the bees and without bees we're SCREWED!!!!!

  7. a couple corrections: farmers didnt GE the sweet potato thousands of years ago, that just happened naturally. all we did was select for sweet potatos we liked. and also there are no GE seed in the global seed vault. if you definition of GMO is that everything is a GMO, then i guess there are GMOs in the global seed vault. you may want to be a bitmore clear on these points, as you were kinda misleading.

  8. Top marks for this! This has been a topic so diluted by politics and scare tactics it seems like no straight answer can be had. One topic here in the US that seems to have no attention, or very little, is on HFC's (High Fructose Corn Syrup). How when it took over as the sweetener for many products, mainly soda, the obesity and the increase in diabetic issues soared. HFC's don't break down in the body as does sugar so the soda that you drink whips fat on you like no tomorrow. It was Washington's butt kiss to farm growers to plant more corn that is not needed to put in products where is doesn't belong. Going back to sugar and drinking in moderation, along with kids getting off their butts and exercise, you will see a considerable drop in being all on fat and kicking early onset of diabetes in youth to the curb.

  9. There is a huge difference between selective and cross breeding and chemically stripping and rebuilding the DNA and splicing it with other species.

  10. one day the government it's going to say f*** it and give the people everything they want and the people are going to hate it they're going to want the government to help

  11. Here in Denmark we can't grow GMOs but we can buy all the GMO goodness we desire, we just import it from abroad.

  12. I'm torn on this subject, while it is true that people have been modifying their food for millennia, and that some GMOs are good for us, where does this idea that science knows best end? I'm not sure I like where this rabbit trail ends. Genetically modified super race anyone? Ethics always tends to lag behind science.

  13. 3:27 That actually is the reason why most people find it alarming. If you don't know that DNA is present in all plant matieral then you need to STFU about GMOs.

  14. Organic Consumers Association is behind efforts labeling of GMOs.

    they also started and funded March against Monsanto

  15. Amazing how afraid people are of GMOs, huh? Even though GMOs like golden rice are going to stamp out world hunger eventually.

  16. The whole "green reputation" thing is BS. At the climate change conference in 2016, the electric car charging stations were fake. One Canadian reporter knocked one over by leaning on it. Virtue signaling much?

  17. Sad to see that Toptenz is going more for shock value than discussion on perspectives. But then again it might improve clicks.

    Nothing against GMO, but when patents/royalties get involved you will have one or a few corporations dictating terms to basic necessities. On many national levels.

    If they would make decisions for the best of the citizens/people, which would hurt their bottom line, they would be against their core principle of improving profit. Stock holders do not know the specifics of the company's activities but they do want a return for their investment. The stockholder is just a good hearted average Joe in many cases, some bad apples do of course exist.

    Example of worst case scenario: UN resolution that defined having access to water is not anymore a human right. Well you can google up the results on people less fortunate.

    The issue with GMO is much more a political debate than an issue with improving technology and crops. Banning patents and royalties for genetical material is not that simple and could brake many important corporations we already rely on. But banning GMO produce is still a possibility (for the short while).

  18. I guess you "people" can't tell the difference between a naturally developed mutation being propagated, and someone with a microscope/instrument splicing foreign DNA into a base chain characteristic of a "host". Typical.

  19. 5) Monsanto getting farmers to use there pesticide and fertilizers which then destroy the natural ecology and make the farmers permanently dependent on Monsanto'a products ? Or Monsanto's purposefully making serial plants? that is to say plants from there seeds which will never be able to reproduces so they can control them and monopolize the market ? Or involvement with developing agent orange ? Or just the fact that they are doing there best to monopolize food all over the world? they are shady wankers and we should all with draw our financial support from them. thats not to say all GMO is bad your point about sweet potato's was well made, but you number 5 barely touches on many of the main issues people take against Monsanto. And you are being silly to dismiss them as just being benign scientists with 'normal' amounts of corporate greed.

  20. Help us translate our videos: https://www.youtube.com/timedtext_cs_queue?msg=10&tab=0 – Learn more why you might want to help: https://support.google.com/youtube/answer/6052538

  21. The ignorance of people makes me so sad. They get frightened by the terminology and make no attempt to understand the concept.

  22. Selective Breeding Problems http://www.pbs.org/wnet/nature/dogs-that-changed-the-world-selective-breeding-problems/1281/

  23. The method of genetic manufacturing alone is nothing one had to be afraid of. But the way corporations are using this technology is quite another ballgame. For example: I have no problems with a genetic modification which results in a slightly better taste or a longer shelf life of the product. But when a plant is changed into developing seven different kinds of poison during its growth and also being resistant against the meanest weed killer known to mankind at the same time — you added seven different poisons and you expect me to eat this Frankenstein food???
    And I am sure you will tell me all these poisons are completely harmless to mankind…
    Sorry, but I do not buy it!

  24. The core topic of genetic manufacturing is NOT to create better food — it is gaining control of all food people are growing on this earth.
    Imagine: on the left is a organic farmer who does not need any gene-tapered crops.
    And on the right there is a farmer who sold his soul to Monsanto, planting and growing GMO-crops.
    Pollinating, the GMO crops spreads its pollen outwards to the fields of the organic farmer, destroying his USP, tainting his crops with genetic manufactured DNA. They destroy the very thing this farmer claims to sell: the natural purity of his crops.
    Then some Monsanto sniffers come along, taking probes from his crop and they find some DNA of their Frankencrops another farmer over there has planted. What happens now is a shame to the American Justice System: The Monsanto sniffers go to court to sue the farmer who has caused nothing, and he must pay big royalties to Monsanto for "using their crops", or he must destroy all of his harvest.
    Does nobody see that the other (Monsanto-) farmer is the culprit who caused the whole mess by spreading his Frankencrops over to his neighbor, destroying the purity of his product which was his economical advantage?

  25. People love to form strong opinions about stuff, whether they know anything about the issue at hand or not, doesn't really play a role. If you care about an issue enough to go out and protest about it, least you could do is read up on it and understand what exactly you are protesting about. Doesn't seem to be a popular opinion tho.

  26. You know that many people who "Anti-GMO" aren't illiterates that blindly against all GMO product. They are just demanding more regulations on modern GMO industries, which it seriously lacks.

  27. I consider those that are anti-GMO to be against the future of the human race. For starters, we have an exponentially increasing world population with only limited land to grow food, which means that we either need crops that offer a higher yield or crops able to grow in areas that were previously unable to grow crops.
    Another reason GMOs can be useful is if the human race expands off Earth, immediate examples would be the moon and Mars. While I do not expect them to grow in a different atmosphere, as humans aren't as easily alterable as plants and we do need the proper composition of air, other factors (water usage, nutrients they absorb from the ground, and sunlight exposure being base examples) have little to no chance of being identical enough to grow food from Earth and must be adapted accordingly.
    While saying this, I still believe such food needs to be tested for safety to the environment and those that eat the crops, a complete ban shows a lack of knowledge and forward thinking

  28. <Sorry – I love you videos, but this one is misleading. Grafting and genetic selection IS NOT the same as adding scorpion DNA into tomatoes. GMOs are mixing different genuses, species, families, etc.

  29. Great video. As always very well rounded and balanced and does try to bust a lot of the myths. My biggest concern with GMO foods though is the way companies like Monsanto prevent farmers from saving seeds (which is a business practice) and also how seeds, once grown, don't produce any further seeds so once the crop has grown you have to return to the company and purchase more. Oh, the insecticide repellent does raise concerns when it comes to bees.

  30. I've never heard of Monsanto before watching this but it's all I can hear!! Monsanto every other word! ahhhhhhhhhh! Monsanto

  31. For heaven's sakes, why can't we just get along with nature and actually learn to live with what we have? High-performance farming yields much more crops than GM plants, as well as no pesticides, allows bees and other insects to pollinate them and even lets people have their own small farms. What I am saying may not agree with your views of GMOs, but mark my words, GMOs should never have been invented for consumption. The downside is the fact that so many people are brainwashed by people by MONSANTO. FOR CRYING OUT LOUD, artificial selection and genetic engineering are not the same. The reason for this is the fact that they are mechanized differently. Artificial selection is just fine as it only selects traits that are in the organism, to begin with. But genetic engineering is taking a gene from a targeted organism and putting it in the host organism for it to have a new trait. The most advanced nations in the world don't utilize GMOs and many of the GMO-based products are a bunch of bullcrap.

  32. Thank you for including crossbreeding in here. I've been trying to explain to people for years that crossbreeding is technically the most commonly used form of genetic modification, and that's generally what they mean by saying all of our produce is GMO.

  33. Why is there only be talked about the food aspect of GMOs? Nobody thinks about all those genetically modified bacteria they use to make medicine.

  34. this is a shill for Monsanto. patenting seeds and suing farmers?? anti monsanto…they are adding stuff into the seeds

  35. Stop the misguided objections to GMOs, and help science and technology save Nature!
    http://www.thepetitionsite.com/442/023/434/stop-the-misguided-objections-to-gmos-and-help-science-and-technology-save-nature/

  36. Very brave of you to tackle this subject! We have an innate fear of Frankenstein, but we need more vigilance against the actual monsters. In this case, as noted in the video, corporate ethics and mass starvation are much more likely to kill us than GMO's.

  37. Now I'm hungry for some juicy baked chicken from a fat GMO hen with some sweet GMO corn while watching some GMO cat videos!

  38. Norman Borlaug, also known as 'The Man Who Saved a Billion People', said GMOs were absolutely necessary if we want to feed more than 4 billion people.

  39. Idaho potatoes are now GMO, so don't buy them. And for the people who say we're silly for being concerned, because there's nothing wrong with GMO food… well, to you I say I'm always concerned when corporations do things in secret that effect us all. If it's so good, why do Monsanto types lie in the name of trade secrets? Evil is as evil does. Wake the fuck up.

  40. There is a huge class action lawsuit in the US against Monsanto, their pesticide: 'roundup'
    has been giving people non Hodgkin's lymphoma. And farmers in India's crops were so much smaller that they poisoned themselves to death with the pesticide. And Bill Gates is on the record ( TED ) saying that the worlds population needs to decrease. Monsanto sues farmers if they dare not use their GMO seeds. So nobody should be defending them…

  41. Monsanto was the a key figure in producing Agent Orange….. so why exactly would any sensible person want a company like that in charge of their food supply?

  42. Yes there is confusion and you are adding to it here. The main reason for GMOs is for monsanto to push their seeds as the ones to be used. The main purpose is not to increase yields or making something more nutritious or better tasting but to create crops that are resistant to Roundup (a Monsanto herbicide). So by saying there is nothing wrong with GMOs you are essentially saying there is nothing wrong with consuming roundup doused vegetable and grain. Your analogy with the sweet potato purportedly being genetically engineered is weak at best.
    Please do some more research before making comments like this.

  43. This is a human gene: TACCGCATCGTAACTCGGCTA; this is a spider gene: TACCGCTAATGCATCA; this is a banana gene: TACGGCTACTGAACTG and this is bacteria gene: TACAAGTCACTGCATCG. It’s all the same, only the number and sequence of these four letters (nucleotides) makes some gene different from another. There are no little spiders in spider genes, or little bananas in banana gene. Genetic code is universal to all life form on Earth. Literally every possible combination of "letters" in gene is possible to occur naturally, so if we want to speed up nature I don't see a problem. We've done that already before.

  44. I just think they should stop modifying seeds so that you have to buy new ones each year instead of being able to use the seeds from the vegetables that you grew.

  45. All this grumbling for nothing. Humans have the tech to do it and they will.

    While the richer nations have the luxury to sit on the wayside debating poorer countries only care about feeding the masses. They will use it irrespective of the position USA or Europe takes.

  46. Fake News detected.
    The evidence regarding the negative health effects of GMO's is overwhelming, and there are thousands of facts and information with real scientists saying the truth of the very real health threats GMO's pose to humans.

  47. injection of interspecies DNA, especially neuro-toxins meant to be insecticide, is a very different thing from selection within a species for desirable traits or splicing similar fruit strains for a hybrid. it is the lack of consideration for collateral and long term damage to the environment. if you drive through the midwest, you will discover 2 related things: 1) no insects on your windshield, which would never happen in any other farming area; 2) the people generally look like white and pink splotched sausages about to burst. the environment in the midwest is very unhealthy for both bugs and people. think again, or as they say in Yorkshire – think on

  48. In reference to #7, Neil deGrasse Tyson on GMO's, see the new movie Food Evolution which he narrates.
    The Food Evolution movie trailer can be found on my channel for your viewing pleasure.  Thank you.

  49. I may not understand the science what I do understand is sick children feeling better after their MOTHERS DOCTORS CHANGE their diet took them off GMO food.

  50. Mildly decent simple comparison. Computing language works in machine language in binary. Assign the 4 base nucleotides as T-00 A-01 -G-10 C-11. For nearly 10,000 years we functioned by writing tables for math down with scrutiny, then we invented algebra, calculus, the calculator, then the computer. I don't see why the recent advancement in our efficiency controlling genetic advancement in crops is somehow inherently bad, it is simply more efficient, safer, and less time consuming, ergo, I find the natural selection and lab based genetic in-equivalency argument absurd. You can make crafts with popsicle sticks, or with the right intent kill somebody with one, however, should we outlaw popsicle sticks? That's why I find the blanket opposition ridiculous and of little merit.

  51. I am one of those who is not oppose to GMO, if anything… we need it as a species. I am however one of those who thinks there needs to be a high ethical standards and oversight, especially business practices.

  52. The problem with GMO's is the non-reproducing seeds that Monsanto likes so much.. No profit in selling seeds that produce more healthy seeds. But plenty of profit in the former and selling seeds each cycle..

  53. sweet potatos weren't developed by farmers who used bacteria. This change was natural made by agrobateria, but the farmers didn't have any imact on it. Read the original artical on PNAS!

  54. It's wise to be skeptical of large corporations and of the government. However in the case of GMOs, it is the hippy fools who are wrong.

  55. The tidbit about how farmers have never actually been attacked by Monsanto for pollen blowing over into their fields…. that's pretty interesting, and new information to me. What's your source for that info? I'd like to know how you know that no farmers, innocent of intentionally using Monsanto products, have been proactively sued by Monsanto. Also, it seems like the fact alone that Monsanto won their court cases (both the original "we can patent life" case and the "you can't proactively sue us before we do anything" case) might be silencing smaller farmers from complaining about mistreatment either by Monsanto or by policies down at the Co-op where they bring their grain, etc. After all, if Monsanto can muster that much legal might, and has won cases in the past they should totally have lost, how can an even moderately wealthy farmer or agricultural company hope to win a court case? Maybe there are farmers who accidentally have that pollen-blown seed but who pay out anyway as the cost of avoiding lawsuits with Goliath.

  56. they go after farmers that use their seeds by turning the farmers into food :ø kidding but ya know..

  57. Its a shame that so much of our worlds intolerance and hate stem from ignorance towards incredibly basic things. I'm betting you'd probably get at least 15-20% of random Americans asked, would sign a petition to outlaw men from marrying and copulating with female homo sapiens – and probably the same number of people would be struck in awe, bewilderment and fear if you told them Nasa have just observed living creatures in advanced societies on the planet Tellus, and they just landed a space travel vessel in the Atlantic ocean.

    Its a sad thing, really. Its also really weird, as much of these things have been part of primary/grade school curriculums for many decades.

  58. While I'll be the first to admit that I'm far from perfect, I DO have a big, big problem with people who are interested in asserting themselves without the bother of knowing – or, in some cases, even thinking upon – what they're talking about. Since the previous sentence ended in a preposition, allow me to state – for the record – that whether my sentences end in prepositions is not something I'm generally concerned with. Now, I have always had a love of learning & of knowledge – both for its [NOT "it's"] practical uses (of course), & for its own sake. History, for instance, is not something I like much in school. But I've since discovered that that's only because my history classes [as mandated by the government at whatever level] SUCKED. As did some of my history teachers (though NOT all.) I've tried to correct this by learning on my own, & have discovered (to my delight) that there is a WEALTH of information out there which is nothing less than fascinating. To me, it adds such a dimension of richness to know the origins & histories of words, traditions, objects, etc., that I can't now imagine the poverty of my own previous knowledge, thoughts & attitudes. I love knowing! NOT because it makes me "superior" in some way to anyone else, but because it makes me a better me. I recall my parents buying me "Golden Explorer" books when I was in grade school. They were magazine-sized, with stiff covers – maybe 20 to 30 pages – and FULL of great stuff to learn about! I had ones about dinosaurs, geology & gems, the planets & stars, etc. I discovered that I had a knack for things like the names of dinosaurs (my favorite one is "pachycephalosaurus" – a wonderfully ugly beast whose name means, "bumpy-headed lizard.") Since then, I've gone on to teach myself about cosmology, particle physics, history, mythology, etc., etc. I am the absolute master of useless trivia! 😉 I don't even like to listen to the radio without knowing what song is playing & by whom. I can't stand it when I ask someone, "Say; what's that song?" and they say, "Oh, I don't know. I just have it on for noise." NOISE? I can't stand it! It's not noise, it's MUSIC! Amazing, beautiful music! Anyway, in the last year I've started really watching YouTube videos, & have discovered that there are videos on practically everything – I've been digging into all kinds of things. And yes, I know there's a lot of crap out there, too. If I could wish for one single thing, it wouldn't be money or anything physical. It would be that everyone now living & everyone to come would be given the same love of knowledge & learning – the same feeling of wonder that I have. I can't say that there would suddenly be less strife in the world – or any crazy claim like that. But I DO think it would be an even more fun place to live! Rikki Tikki.

  59. Most people think of GMO foods as foods genetically modified in a lab by scientists with gene splicing and that's what they are protesting. While it is true that selective breeding and reproducing plants without seeds are methods of genetically modifying them, bioengineering at a cellular level is a completely different animal and is where the controversy you said you would be addressing lays. You failed to do more than afford this controversy any more than a passing reference and then went on to try to prove that protesting GMOs is silly because so many organisms are modified. But, in this case especially, the method is vitally important and your logic is very flawed. You've also left out important information crucial to making an unbiased, informed opinion.

    Animals and foods modified over generations are probably much safer than foods and animals drastically modified in one generation with gene splicing but we really can't know for sure. It takes time and testing to find the problems and/or dangers. Genetic engineering is something completely different from farming and husbandry. It produces tools used in those endeavors but trying to say the different methods of modification are irrelevant is misdirecting and dismissive of real, scientific concerns with products that have been rushed to market for profit at the cost of people's lives and livelihoods.

    Countries that you say have banned GMOs have actually banned 'new organisms', which is a lot more sane than you would have us believe. The actual wording of the law passed in New Zealand in 1996 follows:

    "The importation, development, field testing, and release of “new organisms,” including genetically modified organisms (GMOs), are regulated by the Hazardous Substances and New Organisms Act 1996 (HSNO Act)."

    This law was passed to protect vulnerable native plants and animals from contamination and competition from introduced species. Seems pretty sensible to me. Plants and animals have been forced into extinction, whole ecosystems altered beyond recognition, by invasive species of plants and animals. GMOs are invasive. Testing has proven this. They are designed to be invasive. I think it's perfectly sane for governments to want to protect their lands and people from invasive species of plants and animals. Especially super plants and animals designed to be hardier, less diverse and more abundant than any other plants and animals.

    Also, HELLO – Monsanto in India. Totally evil! Child labour, farmer suicide, socio-economic havoc.

    If you're going to make a science-based video, you might want to start by defining your terms. Trying to say that farming techniques like splicing apple trees is the same thing as splicing genes is absurd. It's pseudo-science based on flawed logic at best. Saying gene splicing carries the same risks and benefits as selective breeding because they both result in genetically modified organisms is like saying coal-fired power plants carry the same risks and benefits as solar farms because they both produce electricity. The risks and benefits of every new organism must be evaluated, just as the environmental impact of every new mega-project for power generation must be evaluated.

    Was this video sponsored by Monsanto? It sure isn't up to your usual standards for evidence-based conclusions.

  60. Genetically modifying plants is neccessary. If you go to mexico, and look very hard you can find wild corn for example. It had around 10 kernels, which were larger, and hard as hell. So hard that you had to boil them to eat them. Almost all of our farming these days has benefitted from genetically modifying things. Without it, veganism would be the same as bretharianism (claiming you dont need to eat or drink to live).
    Now all we need is to genetically modify cows to stop burping and farting and our environment will be saved.

  61. You should have talked about "banana extinction" and how that could be solved with GMO banana trees that are resistant to the disease destroying the banana

  62. Yea… people misunderstand GMOs…. when they splice the DNA with glysophate then we have a problem…. glysophate is a poison and has a LD 50 value…. meaning you dont understand GMOs either…. plus, monsantos is now part of Bayer who knowing gave HIV tainted blood to 1000's of hemophiliacs…. dude, do your research

  63. One of the problems with GMO is they are making them sterile so they can own and sell the seeds.. Also, they enable more pesticides and herbicides on the crop that we eventually are ate by humans….. Also some claim GMOs and the pesticides that they make useable for food crops are killing the Bees

  64. no… Scientists differentiate GMO from methodical breeding for specific traits. Hybridizing and selective breeding for the traits is totally different from "GMO." GMO is when the introduce a totally different gene that could NOT happen in nature. For example, GMO crops often have genes or chemicals added that have nothing in common with the crop on its own. Selection is different then gene splicing guys.

Leave a Reply

Your email address will not be published. Required fields are marked *

Back To Top